copb2

Ensembl ID:
ENSDARG00000038743
ZFIN ID:
ZDB-GENE-010724-7
Description:
coatomer subunit beta' [Source:RefSeq peptide;Acc:NP_001001940]
Human Orthologue:
COPB2
Human Description:
coatomer protein complex, subunit beta 2 (beta prime) [Source:HGNC Symbol;Acc:2232]
Mouse Orthologue:
Copb2
Mouse Description:
coatomer protein complex, subunit beta 2 (beta prime) Gene [Source:MGI Symbol;Acc:MGI:1354962]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39897 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044331 Nonsense 269 934 8 22

The following transcripts of ENSDARG00000038743 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38712978)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39043143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCGGATCTGGCACTCCAGCACTTACCGTCTAGAAAGCACCTTGAACTA[T/A]GGAATGGAGCGGGTTTGGTGTGTGTCTGGCTTGCGGGGCTCCAACAGCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Kawasaki disease: Two new susceptibility loci for Kawasaki disease identified through genome-wide association analysis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link