phf20b

Ensembl ID:
ENSDARG00000038737
ZFIN ID:
ZDB-GENE-040822-33
Description:
PHD finger protein 20, b [Source:RefSeq peptide;Acc:NP_001004114]
Human Orthologue:
PHF20
Human Description:
PHD finger protein 20 [Source:HGNC Symbol;Acc:16098]
Mouse Orthologue:
Phf20
Mouse Description:
PHD finger protein 20 Gene [Source:MGI Symbol;Acc:MGI:2444148]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13159 Nonsense Available for shipment Available now
sa37647 Nonsense Mutation detected in F1 DNA During 2017
sa37646 Nonsense Mutation detected in F1 DNA During 2017
sa17914 Nonsense Available for shipment Available now
sa43928 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14382 Nonsense Available for shipment Available now
sa15420 Nonsense Available for shipment Available now
sa37645 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 54 986 3 18
ENSDART00000121468 Nonsense 54 1030 2 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15136167)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15269046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGAAGATGAGAAAGTTCTGATCCACTACAGACAGTGGAGTCACCGCTA[T/A]GACGAGTGGTTCGACTGGAGCAGTCCGTACCTCAGACCSGTRGAGCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 70 986 3 18
ENSDART00000121468 Nonsense 70 1030 2 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15136121)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15269000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATGACGAGTGGTTCGACTGGAGCAGTCCGTACCTCAGACCCGTGGAG[C/T]GAATCCAGCTGAGGAAACAGGGGCTGAATGAACGACAGTGCGCTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 160 986 6 18
ENSDART00000121468 Nonsense 160 1030 5 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15133368)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15266247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGCAATCAGCAAGCTCGAAAGCGTGCCGATCAGAACGAAAAAGAAT[T/A]GAAACCCAAGGAGAATGGAAACAGCCGGCACAACAGCTCGAGACACAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 233 986 6 18
ENSDART00000121468 Nonsense 233 1030 5 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15133150)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15266029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGATTCAGAGGTGAGTTCTGCTGAGCACCAGCCCAGTGAAGACCAGAAC[C/T]AGCCCAGTGAAGACAAGACCGAAAACCTGGAGAATRGAAATGTAGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Essential Splice Site 301 986 6 18
ENSDART00000121468 Essential Splice Site 301 1030 5 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15132944)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15265823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAAAGTCCTAGTTTGCCCAAGAGGACACGGAGCAGGACGGCAGATGG[T/A]GAGTTTGGTTTGGAGGAACATGCTGGTGTTAGATCTGAATTTTTGATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 580 986 13 18
ENSDART00000121468 Nonsense 624 1030 13 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15117767)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15250646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGATGTGTTGTTGTTGTGTCCTCCAGGTGAAGACAGCAGCAGTGATT[T/A]GTCCTCGGACAGTCCAGTATGGAGTGAGGACGAGTCTGACACTGAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 648 986 14 18
ENSDART00000121468 Nonsense 692 1030 14 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15114580)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15247459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGACGAGTGTCTGTGCTGGCAGCATGGGACRTGTATGGGTCTCTA[T/A]GAGGACAGTGTGCCAGACAGTTACAGCTGCTATATCTGCAGAGACCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056570 Nonsense 669 986 15 18
ENSDART00000121468 Nonsense 713 1030 15 18

The following transcripts of ENSDARG00000038737 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 15112440)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 15245319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTTTGTGATGTAGAAGTGTGTGTGTCTGTATGTGCAGCTCAGAGG[C/T]AGAGTCAGAGGTACTGGTACGATAAAGACTGGCTGAGCAGTGGACACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link