ch25hl2

Ensembl ID:
ENSDARG00000038728
ZFIN ID:
ZDB-GENE-080204-82
Description:
Cholesterol 25-hydroxylase-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A8WGT1]
Human Orthologue:
CH25H
Human Description:
cholesterol 25-hydroxylase [Source:HGNC Symbol;Acc:1907]
Mouse Orthologue:
Ch25h
Mouse Description:
cholesterol 25-hydroxylase Gene [Source:MGI Symbol;Acc:MGI:1333869]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43581 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056560 Nonsense 141 279 1 1
Genomic Location (Zv9):
Chromosome 21 (position 7174061)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7295375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGAATCGTGGGCTGCACGGTGGTGTTCGACTTCCAATACTACTTGTG[G/A]CATCTTTTGCATCACCGCGTCGGCTGGCTGTACCGCACCTTCCATGCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atrioventricular conduction: Identification of genomic predictors of atrioventricular conduction: using electronic medical records as a tool for genome science. (View Study)
  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link