si:ch211-14a17.7

Ensembl ID:
ENSDARG00000038720
ZFIN ID:
ZDB-GENE-030616-590
Description:
hypothetical protein LOC368669 [Source:RefSeq peptide;Acc:NP_001007181]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1906 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044552 Nonsense 26 228 3 10
ENSDART00000112834 Nonsense 109 311 3 9
ENSDART00000132621 Nonsense 109 311 3 10
ENSDART00000148281 Nonsense 26 228 2 9
Genomic Location (Zv9):
Chromosome 2 (position 37986794)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38301708
KASP Assay ID:
554-1896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCACTTCTGTGGCTGAAACYGTGTCTTATCCAGTGGCATGYGTTTTT[G/T]AAAGGTGATTGCTTTGTCCATTTTAGAATGTGTAACTTTAAACCAAKATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link