si:ch211-284o19.1

Ensembl ID:
ENSDARG00000038713
ZFIN ID:
ZDB-GENE-070912-283
Human Orthologue:
TEP1
Human Description:
telomerase-associated protein 1 [Source:HGNC Symbol;Acc:11726]
Mouse Orthologue:
Tep1
Mouse Description:
telomerase associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:109573]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38344 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6856 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32973 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32974 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056536 Essential Splice Site 287 1036 3 19
ENSDART00000141784 Essential Splice Site 287 561 4 11
Genomic Location (Zv9):
Chromosome 2 (position 37641637)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37920769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACTAGCTACCGAGATTACCACAGAAGATCCTGAGTTTGTCCTCAAGG[T/C]TTGTGCATTTGCGTGTGTGAGTGTATGCTTGTTGTGATTTTTGTAGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056536 Essential Splice Site 542 1036 9 19
ENSDART00000141784 Essential Splice Site 538 561 10 11
Genomic Location (Zv9):
Chromosome 2 (position 37644366)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37923498
KASP Assay ID:
554-4388.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCAGCGAGAAACATCACTCTAAGATTCTTAACAGACTGTCCTCGAAG[G/A]TGAGCTAGATTTCTTTCAKTCTTTTGCTCACYGAAAAGTGTGCGTGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056536 Essential Splice Site 635 1036 11 19
ENSDART00000141784   None 561 None 11
Genomic Location (Zv9):
Chromosome 2 (position 37646608)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37925740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTACCGCCTGTTCAACGTCAAACGCAGTCTCATGATAAAAGCAAAG[T/C]GTGTATTGCTCAATATTTTGTTTAAAAAAACTTTACCATAGTTTAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056536 Nonsense 878 1036 17 19
ENSDART00000141784   None 561 None 11
Genomic Location (Zv9):
Chromosome 2 (position 37652954)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37932086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTGGAGAACATGGACAGAGTCTATAACATCCCACCACCACAAGGATG[C/A]CAAAAGGAGCCTGAGAGATCTGCTGACGTCATGCCACTTCAAGCAACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link