hkdc1

Ensembl ID:
ENSDARG00000038703
ZFIN ID:
ZDB-GENE-030131-9801
Description:
putative hexokinase HKDC1 [Source:RefSeq peptide;Acc:NP_001108597]
Human Orthologue:
HKDC1
Human Description:
hexokinase domain containing 1 [Source:HGNC Symbol;Acc:23302]
Mouse Orthologue:
Hkdc1
Mouse Description:
hexokinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384910]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42190 Nonsense Mutation detected in F1 DNA During 2017
sa42189 Nonsense Mutation detected in F1 DNA During 2017
sa42188 Nonsense Mutation detected in F1 DNA During 2017
sa22286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 401 919 9 18
Genomic Location (Zv9):
Chromosome 13 (position 23163887)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22893225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGTGGCTGCAGCTTTGGCTGCCATCCTAACACGGATCAGAGAAAAC[A/T]AAAAGCTGAAGACCCTTCGGACTACTGTAGGAGTGGATGGGACGGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 581 919 12 18
Genomic Location (Zv9):
Chromosome 13 (position 23162961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22892299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTATTTATTTCCGTTTAATTTCAGCTGTTTGACCACATCGTTCAGTG[T/A]ATCTCAGATTTCTTGGACTATATGGGAATGAAGAACACTCGTCTGCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 644 919 13 18
Genomic Location (Zv9):
Chromosome 13 (position 23162632)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22891970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGAAGGGTATGATGTTGTGGACATGCTGAGAGAGGCCATCAAAAGA[C/T]GAAATGTGAGCAGAAAGCAAACATAGTAAAGTAGTTTTACAGATCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056523 Nonsense 739 919 15 18
Genomic Location (Zv9):
Chromosome 13 (position 23161155)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22890493
KASP Assay ID:
2260-6353.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCAGATATGACAGAGAGGTCGACAGCGGCTCACTCAATGCTGGGAAA[C/T]AAAGGTAAATATTACAATGTTTCGATAGTTTTATTATAACATTTTTAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link