nfkb2

Ensembl ID:
ENSDARG00000038687
ZFIN ID:
ZDB-GENE-030131-6701
Description:
nuclear factor NF-kappa-B p100 subunit [Source:RefSeq peptide;Acc:NP_001001840]
Human Orthologue:
NFKB2
Human Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) [Source:HGNC Symbol;
Mouse Orthologue:
Nfkb2
Mouse Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 Gene [Source:MGI Symb

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35472 Nonsense Mutation detected in F1 DNA During 2017
sa22283 Essential Splice Site Available for shipment Available now
sa22284 Nonsense Available for shipment Available now
sa35473 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056499 Nonsense 129 247 7 10
ENSDART00000057672 Nonsense 123 241 6 9
ENSDART00000078289 Nonsense 129 902 6 23
ENSDART00000133064   None 100 None 2
ENSDART00000134122 Nonsense 129 902 7 24
Genomic Location (Zv9):
Chromosome 13 (position 22863870)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22593208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACAGACCCTCCACGAGTTCACGCACACAGCCTTGTGGGTCGACACTG[T/A]AATGAAAGCGGGGTCTGCAGTGTTGATGTCGGGCCTAGTGATTTCACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056499 Essential Splice Site 185 247 8 10
ENSDART00000057672 Essential Splice Site 179 241 7 9
ENSDART00000078289 Essential Splice Site 185 902 7 23
ENSDART00000133064   None 100 None 2
ENSDART00000134122 Essential Splice Site 185 902 8 24
Genomic Location (Zv9):
Chromosome 13 (position 22864156)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22593494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAAGAAGAGAAGAGGAAGGTGAAAGGGCCTGGATATAAGTTTAGTGG[T/A]GAGAGTTATACTATATCGTATATATATATATACGATAACTATTGAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056499   None 247 None 10
ENSDART00000057672   None 241 None 9
ENSDART00000078289 Nonsense 601 902 17 23
ENSDART00000133064   None 100 None 2
ENSDART00000134122 Nonsense 601 902 18 24
Genomic Location (Zv9):
Chromosome 13 (position 22869230)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22598568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCACATATTAAGTTTTTTTTTTTTTTTCACTGTTTACAGGTCAGTA[T/A]CCAGTCCATCTCGCTGTGAAGAAAGATGGAGAGCGTTGTTTGCGATTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056499   None 247 None 10
ENSDART00000057672   None 241 None 9
ENSDART00000078289 Essential Splice Site 840 902 21 23
ENSDART00000133064 Essential Splice Site 55 100 1 2
ENSDART00000134122 Essential Splice Site 840 902 22 24
Genomic Location (Zv9):
Chromosome 13 (position 22871733)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22601071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCAGGACAGCGCTTCACCCTGTCAGAAGCTTCTTGAAAGCTATCAGG[T/G]AAGATACTGTTATTGGTAAACGGATTGCAGGATAGACAAAATCACCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link