tcf7

Ensembl ID:
ENSDARG00000038672
ZFIN IDs:
ZDB-GENE-050222-4, ZDB-GENE-050222-4
Description:
transcription factor 7, T-cell specific [Source:RefSeq peptide;Acc:NP_001012389]
Human Orthologue:
TCF7
Human Description:
transcription factor 7 (T-cell specific, HMG-box) [Source:HGNC Symbol;Acc:11639]
Mouse Orthologue:
Tcf7
Mouse Description:
transcription factor 7, T-cell specific Gene [Source:MGI Symbol;Acc:MGI:98507]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1057 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa1057
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056474 Essential Splice Site 74 274 3 8
ENSDART00000099497 Essential Splice Site 74 252 3 8
Genomic Location (Zv9):
Chromosome 21 (position 44008426)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45282538
KASP Assay ID:
554-0960.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCCCATGCGAGTGATCATGTGTGGTTTTCCTGTGTGTGTTTTCCTGC[A/T]GGTGTTCACAGACATCAGACGCAGGAGATTTCGGGTTTCTACTCGCTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link