tcf7

Ensembl ID:
ENSDARG00000038672
ZFIN IDs:
ZDB-GENE-050222-4, ZDB-GENE-050222-4
Description:
transcription factor 7, T-cell specific [Source:RefSeq peptide;Acc:NP_001012389]
Human Orthologue:
TCF7
Human Description:
transcription factor 7 (T-cell specific, HMG-box) [Source:HGNC Symbol;Acc:11639]
Mouse Orthologue:
Tcf7
Mouse Description:
transcription factor 7, T-cell specific Gene [Source:MGI Symbol;Acc:MGI:98507]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1057 Essential Splice Site F2 line generated During 2014
sa19272 Nonsense Mutation detected in F1 DNA During 2014
sa7973 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1057
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056474 Essential Splice Site 74 274 3 8
ENSDART00000099497 Essential Splice Site 74 252 3 8
Genomic Location:
Chromosome 21 (position 44008426)
KASP Assay ID:
554-0960.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCCCATGCGAGTGATCATGTGTGGTTTTCCTGTGTGTGTTTTCCTGC[A/T]GGTGTTCACAGACATCAGACGCAGGAGATTTCGGGTTTCTACTCGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056474 Nonsense 266 274 8 8
ENSDART00000099497 None None 252 None 8
ENSDART00000056474 Nonsense 266 274 8 8
ENSDART00000099497 None None 252 None 8
Genomic Location:
Chromosome 21 (position 44020023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCCTGGCTCTCCAAAGAAATGCCGCGCTCGCTTCGGCCTGAACCAA[C/T]AGACGGACTGGTGCGGCCCCTGCAGGTGTGTAGACTAACAGCAATGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056474 Nonsense 266 274 8 8
ENSDART00000099497 None None 252 None 8
ENSDART00000056474 Nonsense 266 274 8 8
ENSDART00000099497 None None 252 None 8
Genomic Location:
Chromosome 21 (position 44020023)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCCTGGCTCTCCAAAGAAATGCCGCGCTCGCTTCGGCCTGAACCAA[C/T]AGACGGACTGGTGCGGCCCCTGCAGGTGTGTAGACTAACAGCAATGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0yim0ddc