gbp1

Ensembl ID:
ENSDARG00000038668
ZFIN ID:
ZDB-GENE-040718-32
Description:
guanylate binding protein 1 [Source:RefSeq peptide;Acc:NP_001002343]
Human Orthologues:
GBP1, GBP2, GBP3, GBP4, GBP5, GBP6, GBP7
Human Descriptions:
guanylate binding protein 1, interferon-inducible, 67kDa [Source:HGNC Symbol;Acc:4182]
guanylate binding protein 2, interferon-inducible [Source:HGNC Symbol;Acc:4183]
guanylate binding protein 3 [Source:HGNC Symbol;Acc:4184]
guanylate binding protein 4 [Source:HGNC Symbol;Acc:20480]
guanylate binding protein 5 [Source:HGNC Symbol;Acc:19895]
guanylate binding protein 7 [Source:HGNC Symbol;Acc:29606]
guanylate binding protein family, member 6 [Source:HGNC Symbol;Acc:25395]
Mouse Orthologues:
AC113980.1, Gbp1, Gbp10, Gbp2, Gbp3, Gbp4, Gbp5, Gbp6, Gbp7, Gbp8, Gbp9
Mouse Descriptions:
guanylate binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:95666]
Guanylate binding protein 11 [Source:UniProtKB/TrEMBL;Acc:A9YVJ5]
guanylate binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:102772]
guanylate binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1926263]
guanylate binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:97072]
guanylate binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:2429943]
guanylate binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:2140937]
guanylate binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2444421]
guanylate-binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:4359647]
guanylate-binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1923324]
guanylate-binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:3605620]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32993 Nonsense Available for shipment Available now
sa14292 Essential Splice Site Available for shipment Available now
sa9198 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056460 Nonsense 61 621 2 11
ENSDART00000140788 Nonsense 61 142 2 4

The following transcripts of ENSDARG00000038668 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42133252)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42182716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACTCTACCGTACGGGGAAGTCTTACCTCATGAACCGACTAGCTGGA[C/T]AACAGACAGGTAAGGGAACCATCAAAACTTAAAGCGTTAGTTTACCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056460 Essential Splice Site 106 621 3 11
ENSDART00000140788 Essential Splice Site 106 142 3 4

The following transcripts of ENSDARG00000038668 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42131867)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42181331
KASP Assay ID:
2259-2465.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACACTTTGGTTCTGCTGGACACAGAGGGACTGGGTGATGTTGACAAG[G/T]TGAGGACAAGGCCAGATTTGRTAGTTTTTTGTGWGCYGAAGTTGAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056460 Nonsense 562 621 11 11
ENSDART00000140788   None 142 None 4

The following transcripts of ENSDARG00000038668 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 42122513)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42171977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGAAAGCCATCGACAGCAAACTRAAGGAGCAGGAGGAGATGCTGAAT[A/T]AAGGCTTTAAGGAGAGGGCTGATCTCCTRTCTGAGGARATCAATGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link