gbp1

Ensembl ID:
ENSDARG00000038668
ZFIN ID:
ZDB-GENE-040718-32
Description:
guanylate binding protein 1 [Source:RefSeq peptide;Acc:NP_001002343]
Human Orthologues:
GBP1, GBP2, GBP3, GBP4, GBP5, GBP6, GBP7
Human Descriptions:
guanylate binding protein 1, interferon-inducible, 67kDa [Source:HGNC Symbol;Acc:4182]
guanylate binding protein 2, interferon-inducible [Source:HGNC Symbol;Acc:4183]
guanylate binding protein 3 [Source:HGNC Symbol;Acc:4184]
guanylate binding protein 4 [Source:HGNC Symbol;Acc:20480]
guanylate binding protein 5 [Source:HGNC Symbol;Acc:19895]
guanylate binding protein 7 [Source:HGNC Symbol;Acc:29606]
guanylate binding protein family, member 6 [Source:HGNC Symbol;Acc:25395]
Mouse Orthologues:
AC113980.1, Gbp1, Gbp10, Gbp2, Gbp3, Gbp4, Gbp5, Gbp6, Gbp7, Gbp8, Gbp9
Mouse Descriptions:
guanylate binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:95666]
Guanylate binding protein 11 [Source:UniProtKB/TrEMBL;Acc:A9YVJ5]
guanylate binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:102772]
guanylate binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1926263]
guanylate binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:97072]
guanylate binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:2429943]
guanylate binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:2140937]
guanylate binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2444421]
guanylate-binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:4359647]
guanylate-binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1923324]
guanylate-binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:3605620]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14292 Essential Splice Site Available for shipment Available now
sa9198 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056460 Essential Splice Site 106 621 3 11
ENSDART00000140788 Essential Splice Site 106 142 3 4

The following transcripts of ENSDARG00000038668 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 42131867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACACTTTGGTTCTGCTGGACACAGAGGGACTGGGTGATGTTGACAAG[G/T]TGAGGACAAGGCCAGATTTGRTAGTTTTTTGTGWGCYGAAGTTGAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056460 Nonsense 562 621 11 11
ENSDART00000140788 None None 142 None 4

The following transcripts of ENSDARG00000038668 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 42122513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAGAAAGCCATCGACAGCAAACTRAAGGAGCAGGAGGAGATGCTGAAT[A/T]AAGGCTTTAAGGAGAGGGCTGATCTCCTRTCTGAGGARATCAATGATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/soh6hf29