si:dkey-11c8.1

Ensembl ID:
ENSDARG00000038655
ZFIN ID:
ZDB-GENE-041210-353
Description:
Novel protein similar to human transmembrane protein SHREW1 (SHREW1) [Source:UniProtKB/TrEMBL;Acc:B0
Human Orthologue:
AJAP1
Human Description:
adherens junctions associated protein 1 [Source:HGNC Symbol;Acc:30801]
Mouse Orthologue:
Ajap1
Mouse Description:
adherens junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:2685419]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31652 Nonsense Available for shipment Available now
sa34381 Nonsense Available for shipment Available now
sa27185 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056435 Nonsense 97 384 2 6
ENSDART00000140145 Nonsense 97 386 1 4
Genomic Location (Zv9):
Chromosome 8 (position 22167516)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21597413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGTGTTCTTCCCCCTCCCCTGCCATCAGTAGGCAACCACGGGGAGCAG[G/T]GAGGCAACAAACTGTTAGGGCGGAAAAGCCGCCGGTCAATTCAGAAACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056435 Nonsense 142 384 2 6
ENSDART00000140145 Nonsense 142 386 1 4
Genomic Location (Zv9):
Chromosome 8 (position 22167651)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21597548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGGGAAGTCGGTAACTTTAGCAGAGGGGAGTAAATCTGATGTAAAT[C/T]AGCATTTATCTCGCTCACGGAGGCAGCTGAAAGGGGACAGCTATGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056435 Nonsense 278 384 3 6
ENSDART00000140145 Nonsense 278 386 2 4
Genomic Location (Zv9):
Chromosome 8 (position 22201154)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21631051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGTCCCTCATTATGATCGTCGCAGCCTTGATCACTACTCTAGTCCTT[A/T]AAAACTGGTAGGATACATTCTTTTCTTTCAGTAGAGACTTTCCTGTCTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link