elovl6l

Ensembl ID:
ENSDARG00000038639
ZFIN ID:
ZDB-GENE-031110-3
Description:
elongation of very long chain fatty acids-like 6-like [Source:RefSeq peptide;Acc:NP_958908]
Human Orthologue:
ELOVL6
Human Description:
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) [Sour
Mouse Orthologue:
Elovl6
Mouse Description:
ELOVL family member 6, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9117 Nonsense Mutation detected in F1 DNA During 2014
sa2731 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067537 Nonsense 32 268 2 4

The following transcripts of ENSDARG00000038639 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 21811957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGCAGATTTGTTGTAAACTCTYTTCTTGGTGTCATCTTCTCTTTCAG[G/A]AAAAAGTCGTTTTTGTTTGGCGCTGTGTATGTWGTGCTTGTGTTTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067537 Nonsense 207 268 4 4

The following transcripts of ENSDARG00000038639 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 21808371)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGTGTGCCGAAACCCTGTGCCATCCTCATCACATCCTCTCAGATTGCC[C/T]AGATGGCCATGGGCCTGGCAGTAAGTGCACTAGTGTACCGGTGGATGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l9o1zi6q