magoh

Ensembl ID:
ENSDARG00000038635
ZFIN ID:
ZDB-GENE-041216-1
Description:
Protein mago nashi homolog [Source:UniProtKB/Swiss-Prot;Acc:Q566Y8]
Human Orthologues:
MAGOH, MAGOH3P, MAGOHB
Human Descriptions:
mago-nashi homolog 2, proliferation-associated (Drosophila), pseudogene [Source:HGNC Symbol;Acc:2002
mago-nashi homolog B (Drosophila) [Source:HGNC Symbol;Acc:25504]
mago-nashi homolog, proliferation-associated (Drosophila) [Source:HGNC Symbol;Acc:6815]
Mouse Orthologues:
Magoh, Magohb
Mouse Descriptions:
mago-nashi homolog B (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913691]
mago-nashi homolog, proliferation-associated (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1330312]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13657 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056405 Essential Splice Site 87 147 3 5
Genomic Location:
Chromosome 8 (position 21672185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGAAGACGATGCCTTGTGGCCTCCTCCGGACAGGGTTGGCAGACAG[G/T]TTTGTTGTAATGTATATTATTTCTTCTTGATTTTTGCCCTTTGTTCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g3ek1nwg