ENSDARG00000038624

Ensembl ID:
ENSDARG00000038624
Human Orthologues:
AC009958.4, AC110080.2, AC110080.4, AC110080.7, AC110080.8, AC233264.1, AC233264.4, AC233264.6, AC233264.7, IGKC
Human Descriptions:
Ig kappa chain V-II region Cum [Source:UniProtKB/Swiss-Prot;Acc:P01614]
Ig kappa chain V-II region RPMI 6410 [Source:UniProtKB/Swiss-Prot;Acc:P06310]
immunoglobulin kappa constant [Source:HGNC Symbol;Acc:5716]
Mouse Orthologues:
AC140374.1, Gm10878, Gm16634, Gm16688, Gm16797, Gm16798, Gm16800, Gm16904, Gm16955, Gm4964, Gm4965, Gm5153, Gm5572, Gm6827, Gm6832, Igk-V
Mouse Descriptions:
immunoglobulin kappa chain complex variable region Complex/Cluster/Region [Source:MGI Symbol;Acc:MGI
predicted gene 10878 Gene [Source:MGI Symbol;Acc:MGI:3642626]
predicted gene 4964 Gene [Source:MGI Symbol;Acc:MGI:3819952]
predicted gene 4965 Gene [Source:MGI Symbol;Acc:MGI:3648800]
predicted gene 5153 Gene [Source:MGI Symbol;Acc:MGI:3644894]
predicted gene 5572 Gene [Source:MGI Symbol;Acc:MGI:3647785]
predicted gene 6827 Gene [Source:MGI Symbol;Acc:MGI:3648380]
predicted gene 6832 Gene [Source:MGI Symbol;Acc:MGI:3645551]
predicted gene, 16634 Gene [Source:MGI Symbol;Acc:MGI:4439558]
predicted gene, 16688 Gene [Source:MGI Symbol;Acc:MGI:4439612]
predicted gene, 16797 Gene [Source:MGI Symbol;Acc:MGI:4439721]
predicted gene, 16798 Gene [Source:MGI Symbol;Acc:MGI:4439722]
predicted gene, 16800 Gene [Source:MGI Symbol;Acc:MGI:4439724]
predicted gene, 16904 Gene [Source:MGI Symbol;Acc:MGI:4439828]
predicted gene, 16955 Gene [Source:MGI Symbol;Acc:MGI:4439879]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25218 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056388 Nonsense 50 120 2 2
Genomic Location:
Chromosome 24 (position 39718042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGACAAAACCATCACAATCACCTGCAGAACCAGCACAGATGTGTAC[A/T]GATATTATGATGGAGACCAAACTTTAGCCTGGTATTTCCAGAAACCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s5jj5nc8