mgc35261l

Ensembl ID:
ENSDARG00000038612
ZFIN ID:
ZDB-GENE-040722-2
Description:
hypothetical protein LOC432386 [Source:RefSeq peptide;Acc:NP_001002309]
Human Orthologue:
CXorf41
Human Description:
chromosome X open reading frame 41 [Source:HGNC Symbol;Acc:28570]
Mouse Orthologues:
4930521A18Rik, E230019M04Rik
Mouse Descriptions:
RIKEN cDNA 4930521A18 gene Pseudogene [Source:MGI Symbol;Acc:MGI:1921958]
RIKEN cDNA E230019M04 gene Gene [Source:MGI Symbol;Acc:MGI:3607720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33013 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056375 Nonsense 69 194 3 6

The following transcripts of ENSDARG00000038612 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 44465754)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44551255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTAGGTAGCACTAGTGCCTATGTGAAGAAGAACAGCAAAGACATCT[G/A]GGATGAGGCTGAGGTGACCGAAGGGGCACATTTTGATGACCTCAATGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link