mpz

Ensembl ID:
ENSDARG00000038609
ZFIN ID:
ZDB-GENE-010724-4
Description:
myelin protein P0 [Source:RefSeq peptide;Acc:NP_919342]
Human Orthologue:
MPZ
Human Description:
myelin protein zero [Source:HGNC Symbol;Acc:7225]
Mouse Orthologue:
Mpz
Mouse Description:
myelin protein zero Gene [Source:MGI Symbol;Acc:MGI:103177]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa62 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa62
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056372 Nonsense 48 203 2 6
ENSDART00000109251 Nonsense 48 203 2 6
ENSDART00000132682 Nonsense 48 203 2 6
ENSDART00000136818 None None 165 None 5

The following transcripts of ENSDARG00000038609 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 44341570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCATTGGTGGGCTCAGATGTCAGACTCTCCTGCTCTTTCTTCTCCTGG[C/T]AGTGGACTTCTCCAGAAGTGTCCTTTACATGGCATTACCGTCCAGATGGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mmg4czj7