lar

Ensembl ID:
ENSDARG00000038590
ZFIN ID:
ZDB-GENE-980605-15
Human Orthologue:
PTPRS
Human Description:
protein tyrosine phosphatase, receptor type, S [Source:HGNC Symbol;Acc:9681]
Mouse Orthologue:
Ptprs
Mouse Description:
protein tyrosine phosphatase, receptor type, S Gene [Source:MGI Symbol;Acc:MGI:97815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19915 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050551 Nonsense 151 582 4 12
Genomic Location:
Chromosome 2 (position 59711910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGATCAGTACTGGCCCAGTCGTGGCACAGACTCATTCGGGGCGGTG[C/T]AGGTCAGTCTGCTGGACACTATGGAGCTGGCCACCTTCTGTGTGCGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9pful9pj