lar

Ensembl ID:
ENSDARG00000038590
ZFIN ID:
ZDB-GENE-980605-15
Human Orthologue:
PTPRS
Human Description:
protein tyrosine phosphatase, receptor type, S [Source:HGNC Symbol;Acc:9681]
Mouse Orthologue:
Ptprs
Mouse Description:
protein tyrosine phosphatase, receptor type, S Gene [Source:MGI Symbol;Acc:MGI:97815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38364 Nonsense Mutation detected in F1 DNA During 2016
sa19915 Nonsense Available for shipment Available now
sa33065 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050551 Nonsense 43 582 2 12
Genomic Location (Zv9):
Chromosome 2 (position 59713101)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58693165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTTTCAGTCGATTGACCCTGGGCAGCAGTTCACGTGG[G/T]AACACTCCAACCTGGAGGTAAACAAGCAGAAGAACCGCTATGCTAACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050551 Nonsense 151 582 4 12
Genomic Location (Zv9):
Chromosome 2 (position 59711910)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58691974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGATCAGTACTGGCCCAGTCGTGGCACAGACTCATTCGGGGCGGTG[C/T]AGGTCAGTCTGCTGGACACTATGGAGCTGGCCACCTTCTGTGTGCGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050551 Nonsense 261 582 6 12
Genomic Location (Zv9):
Chromosome 2 (position 59709646)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58689710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGGAGCGAGCGGTGGATGTGTACGGTCACGTCACCCTGATGCGCTCG[C/T]AGCGGAACTACATGGTGCAGACGGAGGATCAGTACGGCTTCATCCACGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link