scg2b

Ensembl ID:
ENSDARG00000038574
ZFIN ID:
ZDB-GENE-061103-160
Description:
secretogranin-2 [Source:RefSeq peptide;Acc:NP_001071216]
Human Orthologue:
SCG2
Human Description:
secretogranin II [Source:HGNC Symbol;Acc:10575]
Mouse Orthologue:
Scg2
Mouse Description:
secretogranin II Gene [Source:MGI Symbol;Acc:MGI:103033]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19871 Nonsense Available for shipment Available now
sa19872 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112579 Nonsense 311 583 2 2
Genomic Location (Zv9):
Chromosome 2 (position 47706343)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47729451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGATTACTACCTGTTGAAGGTCTTGGAGATGACAGATCAAGCACAA[A/T]AGCGGGATCTGATGGAAGGAAGGAGGAGGCTGCTCTCTCGACCCTCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112579 Nonsense 462 583 2 2
Genomic Location (Zv9):
Chromosome 2 (position 47706796)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47729904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTAGACGAGGAAGCCTGTTCCTCTCAGAGTTAAACAAAGCTCCGAGC[A/T]AAAGAAAAGACGACTATGATGATGACGATGCGGTAGATGAAGATGAGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link