fzd8b

Ensembl ID:
ENSDARG00000038569
ZFIN ID:
ZDB-GENE-000328-4
Description:
frizzled homolog 8b [Source:RefSeq peptide;Acc:NP_571628]
Human Orthologue:
FZD8
Human Description:
frizzled homolog 8 (Drosophila) [Source:HGNC Symbol;Acc:4046]
Mouse Orthologue:
Fzd8
Mouse Description:
frizzled homolog 8 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108460]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19879 Nonsense Mutation detected in F1 DNA During 2014
sa1798 Missense F2 line generated During 2014

Mutation Details

Allele Name:
sa19879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056305 Nonsense 85 576 1 1
Genomic Location:
Chromosome 2 (position 48071402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCCCTCGTGGAGATCCAGTGTTCCCCTGACCTGCGCTTCTTTTTGTG[C/A]AGTATGTACACGCCTATTTGCTTGGAGGATTATAAGAAACCTTTGCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1798
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056305 Missense 94 576 1 1
Genomic Location:
Chromosome 2 (position 48071376)
KASP Assay ID:
554-1790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGACCTGCGCTTCTTTTTGTGCAGTATGTACACGCCTATTTGCTTGG[A/T]GGATTATAAGAAACCTTTGCCGCCGTGCAGGAGTGTGTGCGAGCGGGCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mczx9161