gnptg

Ensembl ID:
ENSDARG00000038566
ZFIN ID:
ZDB-GENE-040625-18
Description:
N-acetylglucosamine-1-phosphotransferase subunit gamma [Source:RefSeq peptide;Acc:NP_001002057]
Human Orthologue:
GNPTG
Human Description:
N-acetylglucosamine-1-phosphate transferase, gamma subunit [Source:HGNC Symbol;Acc:23026]
Mouse Orthologue:
Gnptg
Mouse Description:
N-acetylglucosamine-1-phosphotransferase, gamma subunit Gene [Source:MGI Symbol;Acc:MGI:2147006]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13050 Nonsense Available for shipment Available now
sa44180 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056302 Nonsense 224 275 9 10
ENSDART00000141771 Nonsense 269 320 9 10
Genomic Location (Zv9):
Chromosome 24 (position 38857374)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37456592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCGTTGTAAACAAGCGTGTYTGTTTTAACAGGACTTTGAAAAGCAG[C/T]GAACAGAGATCGAACGGCTTCAGTCACTCCTAAMACAACACAACATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056302 Nonsense 236 275 9 10
ENSDART00000141771 Nonsense 281 320 9 10
Genomic Location (Zv9):
Chromosome 24 (position 38857410)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37456628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGAAAAGCAGCGAACAGAGATCGAACGGCTTCAGTCACTCCTAAAA[C/T]AACACAACATCTCCTATGAGGCGACAGCAGGTGAGACGCATACAAAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link