gnptg

Ensembl ID:
ENSDARG00000038566
ZFIN ID:
ZDB-GENE-040625-18
Description:
N-acetylglucosamine-1-phosphotransferase subunit gamma [Source:RefSeq peptide;Acc:NP_001002057]
Human Orthologue:
GNPTG
Human Description:
N-acetylglucosamine-1-phosphate transferase, gamma subunit [Source:HGNC Symbol;Acc:23026]
Mouse Orthologue:
Gnptg
Mouse Description:
N-acetylglucosamine-1-phosphotransferase, gamma subunit Gene [Source:MGI Symbol;Acc:MGI:2147006]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13050 Nonsense Available for shipment Available now
sa44180 Nonsense Mutation detected in F1 DNA During 2016
sa19348 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056302 Nonsense 224 275 9 10
ENSDART00000141771 Nonsense 269 320 9 10
Genomic Location:
Chromosome 24 (position 38857374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCGTTGTAAACAAGCGTGTYTGTTTTAACAGGACTTTGAAAAGCAG[C/T]GAACAGAGATCGAACGGCTTCAGTCACTCCTAAMACAACACAACATCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056302 Nonsense 236 275 9 10
ENSDART00000141771 Nonsense 281 320 9 10
Genomic Location:
Chromosome 24 (position 38857410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGAAAAGCAGCGAACAGAGATCGAACGGCTTCAGTCACTCCTAAAA[C/T]AACACAACATCTCCTATGAGGCGACAGCAGGTGAGACGCATACAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056302 Nonsense 253 275 10 10
ENSDART00000141771 Nonsense 298 320 10 10
Genomic Location:
Chromosome 24 (position 38860712)
KASP Assay ID:
554-6215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAAACCAGTTCCCTCTCTCTCCCAGACAGGACTGAGGATCGGGGTTA[C/A]ACTGAACCTTCACCTGTCCAGGACCAGCACCTCCGCGGAGATGGCGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link