pitrm1

Ensembl ID:
ENSDARG00000038563
ZFIN ID:
ZDB-GENE-040426-2876
Description:
Presequence protease, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVZ6]
Human Orthologue:
PITRM1
Human Description:
pitrilysin metallopeptidase 1 [Source:HGNC Symbol;Acc:17663]
Mouse Orthologue:
Pitrm1
Mouse Description:
pitrilysin metallepetidase 1 Gene [Source:MGI Symbol;Acc:MGI:1916867]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25120 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31298 Nonsense Available for shipment Available now
sa25121 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33024 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056294 Essential Splice Site 84 1023 None 27

The following transcripts of ENSDARG00000038563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 48208166)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48239830
KASP Assay ID:
554-7294.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTATGCCCCATTGATGTCCACATTCCTTTGCCTGTGTGTTTTTAT[A/T]GCGTGCTGTTTCGTACCACCCCAATGGACAGCACTGGTGTTCCTCACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056294 Nonsense 138 1023 5 27

The following transcripts of ENSDARG00000038563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 48209464)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48241128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGGTTTATCTTTCTCATGATTTTAATCTCTCCTTCAGCCAGCGATTA[C/A]ACCATGTACCCGTTCTCCACCCAGAATGCCAAAGACTTCAAGAACCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056294 Essential Splice Site 575 1023 16 27

The following transcripts of ENSDARG00000038563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 48221468)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48253132
KASP Assay ID:
554-7538.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGACACGACTACTTTGAAAATCCTGCAGTCTTTTTGTGTGTGTGTA[G/A]GTGGTGTACCTGTACAGTACTGTGAGCAGCCCACCAACGGCATGGTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056294 Splice Site, Nonsense 909 1023 24 27

The following transcripts of ENSDARG00000038563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 48229958)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48261622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGCGGAGCTAGAATGGGAGGAGGCGGCCTGTTCTCCTTTTATTCCTA[C/A]AGGTACAAATGAATGAAAGCTTGTGAGATGCACATGAATTTTTTATATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link