ccr12.3

Ensembl ID:
ENSDARG00000038541
ZFIN ID:
ZDB-GENE-060503-97
Description:
C-C chemokine receptor family-like [Source:RefSeq peptide;Acc:NP_001038492]
Human Orthologue:
XCR1
Human Description:
chemokine (C motif) receptor 1 [Source:HGNC Symbol;Acc:1625]
Mouse Orthologue:
Xcr1
Mouse Description:
chemokine (C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1346338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19895 Nonsense Available for shipment Available now
sa5170 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056246 Nonsense 75 356 1 1
ENSDART00000145888 Nonsense 74 355 2 2
Genomic Location:
Chromosome 2 (position 50555245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCTTGCTTGGGAATGGACTGGTGCTGTGTATCATCTACAAGTTCGAG[A/T]AGCTCAGCACGGTCACCAATATCTTCTTACTCAACCTCGTGATATCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056246 Nonsense 328 356 1 1
ENSDART00000145888 Nonsense 327 355 2 2
Genomic Location:
Chromosome 2 (position 50554486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTTTTTGGGGAAGAAGTTCCAGAGTCATTTTCTGAAGCTTCTGTCC[A/T]AGCGTATWCCATGTCTRAAGATTGATGCCATGTGGTCTACACAGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kuczujof