ccr12.3

Ensembl ID:
ENSDARG00000038541
ZFIN ID:
ZDB-GENE-060503-97
Description:
C-C chemokine receptor family-like [Source:RefSeq peptide;Acc:NP_001038492]
Human Orthologue:
XCR1
Human Description:
chemokine (C motif) receptor 1 [Source:HGNC Symbol;Acc:1625]
Mouse Orthologue:
Xcr1
Mouse Description:
chemokine (C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1346338]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33043 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19895 Nonsense Available for shipment Available now
sa33042 Nonsense Mutation detected in F1 DNA During 2016
sa5170 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056246   None 356 None 1
ENSDART00000145888 Essential Splice Site None 355 1 2
Genomic Location:
Chromosome 2 (position 50555563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTAAGCTGCGGAGAGTTTCACACTCGCTCCTTTACTCAAGCCATCGG[T/C]GAGTGAAGCCAAACATATGATGATCTCAGAATAACCTCAATTTAAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056246 Nonsense 75 356 1 1
ENSDART00000145888 Nonsense 74 355 2 2
Genomic Location:
Chromosome 2 (position 50555245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCTTGCTTGGGAATGGACTGGTGCTGTGTATCATCTACAAGTTCGAG[A/T]AGCTCAGCACGGTCACCAATATCTTCTTACTCAACCTCGTGATATCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056246 Nonsense 214 356 1 1
ENSDART00000145888 Nonsense 213 355 2 2
Genomic Location:
Chromosome 2 (position 50554828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAATCAGACATTCCTCACAAAGTGGGAGCTTATCGGCTATTATCAG[C/T]AGTTTTTCCTCTTCTTTATGGTTCCTCTGATTATCGTTTTGTACTGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056246 Nonsense 328 356 1 1
ENSDART00000145888 Nonsense 327 355 2 2
Genomic Location:
Chromosome 2 (position 50554486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTTTTTGGGGAAGAAGTTCCAGAGTCATTTTCTGAAGCTTCTGTCC[A/T]AGCGTATWCCATGTCTRAAGATTGATGCCATGTGGTCTACACAGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link