gga1

Ensembl ID:
ENSDARG00000038537
ZFIN ID:
ZDB-GENE-040822-13
Description:
ADP-ribosylation factor-binding protein GGA1 [Source:RefSeq peptide;Acc:NP_001004000]
Human Orthologue:
GGA1
Human Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 1 [Source:HGNC Symbol;Acc:17842]
Mouse Orthologue:
Gga1
Mouse Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11719 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038818 Essential Splice Site 380 635 12 17
Genomic Location:
Chromosome 6 (position 23815507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGACTTCTTCCCAATCTGGAGATGCTATGGGGTGGAATACTTTTCAGG[T/C]GGGCAGATAAATAAKTTTCATCTATTTGTTCTGATTGTGTGACAATTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eg1uuob9