ENSDARG00000038532

Ensembl ID:
ENSDARG00000038532
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21145 Nonsense Mutation detected in F1 DNA During 2014
sa8621 Nonsense Mutation detected in F1 DNA During 2014
sa8447 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088854 Nonsense 246 840 3 6
Genomic Location:
Chromosome 7 (position 71981904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACAGCTCAGGAGGAGGGGATTTGTGTTGAGTACTCAGAAAAATTCTA[T/A]CGAACAGATCCTGAGAAACTTAGAAAAGTAGTAGACACAATTAAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088854 Nonsense 538 840 6 6
ENSDART00000088854 Nonsense 538 840 6 6
Genomic Location:
Chromosome 7 (position 71983843)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATACTTTTATTTCTAATTGCTGTAATAACTGTAATTTTCTTCCAGATT[C/A]AGTTAACTGCAAACAGTGTCCAGGGGAGTACTGGTCTAATGCTGAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088854 Nonsense 538 840 6 6
ENSDART00000088854 Nonsense 538 840 6 6
Genomic Location:
Chromosome 7 (position 71983843)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATACTTTTATTTCTAATTGCTGTAATAACTGTAATTTTCTTCCAGATT[C/A]AGTTAACTGCAAACAGTGTCCAGGGGAGTACTGGTCTAATGCTGAGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r9shfqqc