LOC100330957

Ensembl ID:
ENSDARG00000038530
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32797 Nonsense Available for shipment Available now
sa39725 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056226 Nonsense 330 536 5 5
Genomic Location (Zv9):
Chromosome 1 (position 58246932)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57097250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATGAAGCGCACGTGTGTGGAAAGAGCATCACCATAATCGACACTCCG[G/T]GACTGACTGATGCGTCTCAGAAGACGACGAAAAAGGAAATCCAGAAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056226 Nonsense 401 536 5 5
Genomic Location (Zv9):
Chromosome 1 (position 58246719)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57097037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATGCTGCACATTACTCCATCGTACTGTTCACTCATGGGGATTTGGAG[A/T]AATTGATCAACAAAAATAATGAAGACAGTCCTGATTTTCATGCGTTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link