pik3r1

Ensembl ID:
ENSDARG00000038524
ZFIN ID:
ZDB-GENE-030131-1280
Description:
Phosphoinositide-3-kinase, regulatory subunit 1 (P85 alpha) [Source:UniProtKB/TrEMBL;Acc:B0S6V6]
Human Orthologue:
PIK3R1
Human Description:
phosphoinositide-3-kinase, regulatory subunit 1 (alpha) [Source:HGNC Symbol;Acc:8979]
Mouse Orthologue:
Pik3r1
Mouse Description:
phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) Gene [Source:MGI Symbol

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu7903 Essential Splice Site Available for shipment Available now
sa40561 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20533 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu7903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040871   None 727 None 15
ENSDART00000056213 Essential Splice Site None 727 2 16
ENSDART00000122829   None 449 None 10

The following transcripts of ENSDARG00000038524 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 55229381)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54168088
KASP Assay ID:
554-2393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTGTTGATGTTGTTCAACGTGTACATTGATTTATCTTCTGTGTTGTA[G/A]GTTTGAATTACTCTTTTTAGATCACTGGGAGCAGGCCTCACACAGATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040871 Essential Splice Site 143 727 2 15
ENSDART00000056213 Essential Splice Site 143 727 3 16
ENSDART00000122829   None 449 None 10

The following transcripts of ENSDARG00000038524 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 55216669)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54155376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCACCATCTATGCTGCTGAAGCTCCTTGAGGCCATTGAGAAGAAAGG[T/A]AAATCTGTCATGTGTTCGCATACATTGTAATTATTGCATTTTCTGCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040871 Nonsense 498 727 11 15
ENSDART00000056213 Nonsense 498 727 12 16
ENSDART00000122829 Nonsense 220 449 6 10

The following transcripts of ENSDARG00000038524 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 55209057)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54147764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGACTGCTATTGAAGCTTTTAATGAGACCATTAAGATCTTTGAAGAG[C/T]AGTGCCAGACGCAAGAACGATACAGCAAAGAATATATTGAGAAGTTTAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link