nrp2b

Ensembl ID:
ENSDARG00000038446
ZFIN ID:
ZDB-GENE-040611-3
Description:
neuropilin 2b [Source:RefSeq peptide;Acc:NP_998131]
Human Orthologue:
NRP2
Human Description:
neuropilin 2 [Source:HGNC Symbol;Acc:8005]
Mouse Orthologue:
Nrp2
Mouse Description:
neuropilin 2 Gene [Source:MGI Symbol;Acc:MGI:1100492]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41380 Nonsense Mutation detected in F1 DNA During 2017
sa34591 Essential Splice Site Available for shipment Available now
sa34590 Nonsense Mutation detected in F1 DNA During 2017
sa7177 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056103 Nonsense 140 920 3 17
ENSDART00000056103 Nonsense 140 920 3 17
ENSDART00000056103 Nonsense 140 920 3 17
Genomic Location (Zv9):
Chromosome 9 (position 14746080)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14498645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACTACGCCCACCAGGGGGCAGGGTTTTCGCTGCGCTATGAAATCTA[T/G]AAGACAGGTAAGCACGCGTTACTCAGCATGATGTACTGCATCATTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056103 Essential Splice Site 593 920 10 17
Genomic Location (Zv9):
Chromosome 9 (position 14685196)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14437761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGCTGGCATTGGGATGAGAATGGAGATACTGGCTTGTGACTTGCCAGG[T/G]AAGACCCATTTTATTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056103 Nonsense 649 920 12 17
Genomic Location (Zv9):
Chromosome 9 (position 14663139)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14415704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGAGTATGTGTGGATGGACCCACGACCCCATGTCTGATCTGAAGTG[G/A]TCTATGTATAGTTCCTCCAGTCCGAGTTTGGACCTGACACACGGACCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056103 Nonsense 681 920 13 17
Genomic Location (Zv9):
Chromosome 9 (position 14657489)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14410054
KASP Assay ID:
554-4893.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNGCTGCAGATTTTGGGAATTTCCTGTATGTGGAAGCGAGTCCCATGTCA[G/T]AGYCTCAGCGGGCACGKTTATTGAGCCCATCGGTGGGACCYGAACGGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link