csrnp1b

Ensembl ID:
ENSDARG00000038429
ZFIN ID:
ZDB-GENE-030131-1515
Description:
cysteine/serine-rich nuclear protein 1 [Source:RefSeq peptide;Acc:NP_955913]
Human Orthologue:
CSRNP1
Human Description:
cysteine-serine-rich nuclear protein 1 [Source:HGNC Symbol;Acc:14300]
Mouse Orthologue:
Csrnp1
Mouse Description:
cysteine-serine-rich nuclear protein 1 Gene [Source:MGI Symbol;Acc:MGI:2387989]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18280 Nonsense Available for shipment Available now
sa44119 Nonsense Mutation detected in F1 DNA During 2016
sa39443 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056082 Nonsense 246 433 4 6
ENSDART00000109107 Nonsense 246 566 4 5
ENSDART00000135405   None 201 None 4

The following transcripts of ENSDARG00000038429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20258162)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19564316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTCTGTGAGCCAGAGACCTGCAGCTGTAGTTTGGCTGGGATCAAATG[T/A]CAGGTAAGCAATTCCCAACAGACTTCTTTGAGAACATCAYYTACCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056082 Nonsense 331 433 5 6
ENSDART00000109107 Nonsense 331 566 5 5
ENSDART00000135405   None 201 None 4

The following transcripts of ENSDARG00000038429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20257795)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19563949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGAGATCAGCAGCACGCCAGACATGCCAACATTTCACTTTAACTCA[G/T]AGCTACTATCCACAGGAGAGAACAGCTGCAGCAGTGACATGACCGATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056082   None 433 None 6
ENSDART00000109107 Nonsense 495 566 5 5
ENSDART00000135405   None 201 None 4

The following transcripts of ENSDARG00000038429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 20257301)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 19563455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTAGAATTCTTTGATGGATTTCCTTGTTTGGGACCGAGCTCGCTATA[C/A]AACTCCCTAAAGGAGTATGAGCACGTGGACAACTTCTTTCAGTTCCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link