csrnp1b

Ensembl ID:
ENSDARG00000038429
ZFIN ID:
ZDB-GENE-030131-1515
Description:
cysteine/serine-rich nuclear protein 1 [Source:RefSeq peptide;Acc:NP_955913]
Human Orthologue:
CSRNP1
Human Description:
cysteine-serine-rich nuclear protein 1 [Source:HGNC Symbol;Acc:14300]
Mouse Orthologue:
Csrnp1
Mouse Description:
cysteine-serine-rich nuclear protein 1 Gene [Source:MGI Symbol;Acc:MGI:2387989]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18280 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056082 Nonsense 246 433 4 6
ENSDART00000109107 Nonsense 246 566 4 5
ENSDART00000135405 None None 201 None 4

The following transcripts of ENSDARG00000038429 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 20258162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTCTGTGAGCCAGAGACCTGCAGCTGTAGTTTGGCTGGGATCAAATG[T/A]CAGGTAAGCAATTCCCAACAGACTTCTTTGAGAACATCAYYTACCAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qr0schso