taf2

Ensembl ID:
ENSDARG00000038423
ZFIN IDs:
ZDB-GENE-030131-3207, ZDB-GENE-030131-3848
Description:
Transcription initiation factor TFIID subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q32PW3]
Human Orthologue:
TAF2
Human Description:
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf2
Mouse Description:
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28589 Nonsense Mutation detected in F1 DNA During 2015
sa22760 Nonsense Available for shipment Available now
sa25004 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa28589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 13 1191 2 27
Genomic Location:
Chromosome 16 (position 11049058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCGAAGAAAGAATGAACCGCAAGAAAGACAAGGGCTTTGAGAGCCCA[C/T]GACCATATAAACTATAAGTATCAAATACGTTTTGTCTCTCACTGAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 533 1191 14 27
Genomic Location:
Chromosome 16 (position 11060094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGTCAAATTTTTTGGAAGTTTTGCTTTTAACAGGAAAAGAAATGTTT[T/A]GGAACTAGAGATTCGCCAGGACTACACATCATCAGGCACACAGAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 595 1191 16 27
Genomic Location:
Chromosome 16 (position 11060499)
KASP Assay ID:
554-7431.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACTTGTTTTGATTGCTTTTGGCAGGAACAAGAAAAAGAAAATCCCTT[T/A]GATGAATGGAGAAGAAGTTGATATGGACTTGTCAGCCATGGAGTAAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k5tvwp2m