taf2

Ensembl ID:
ENSDARG00000038423
ZFIN IDs:
ZDB-GENE-030131-3207, ZDB-GENE-030131-3848
Description:
Transcription initiation factor TFIID subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q32PW3]
Human Orthologue:
TAF2
Human Description:
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf2
Mouse Description:
TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22760 Nonsense Available for shipment Available now
sa25004 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 533 1191 14 27
Genomic Location:
Chromosome 16 (position 11060094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGTCAAATTTTTTGGAAGTTTTGCTTTTAACAGGAAAAGAAATGTTT[T/A]GGAACTAGAGATTCGCCAGGACTACACATCATCAGGCACACAGAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056072 Nonsense 595 1191 16 27
Genomic Location:
Chromosome 16 (position 11060499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACTTGTTTTGATTGCTTTTGGCAGGAACAAGAAAAAGAAAATCCCTT[T/A]GATGAATGGAGAAGAAGTTGATATGGACTTGTCAGCCATGGAGTAAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k5tvwp2m