entpd4

Ensembl ID:
ENSDARG00000038422
ZFIN ID:
ZDB-GENE-040718-116
Description:
ectonucleoside triphosphate diphosphohydrolase 4 [Source:RefSeq peptide;Acc:NP_001002419]
Human Orthologue:
ENTPD4
Human Description:
ectonucleoside triphosphate diphosphohydrolase 4 [Source:HGNC Symbol;Acc:14573]
Mouse Orthologue:
Entpd4
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 4 Gene [Source:MGI Symbol;Acc:MGI:1914714]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6105 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Nonsense 281 611 8 13
Genomic Location:
Chromosome 8 (position 52631767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACRGCTGGTGTTTTGGACATGGGTGGCGTYTCCACTCAGATCGCATA[T/A]GAAGTGCCCAAAACTGTAAGCTTTGCTTCTCCACAACAGGTTATTATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sgvvzafp