entpd4

Ensembl ID:
ENSDARG00000038422
ZFIN ID:
ZDB-GENE-040718-116
Description:
ectonucleoside triphosphate diphosphohydrolase 4 [Source:RefSeq peptide;Acc:NP_001002419]
Human Orthologue:
ENTPD4
Human Description:
ectonucleoside triphosphate diphosphohydrolase 4 [Source:HGNC Symbol;Acc:14573]
Mouse Orthologue:
Entpd4
Mouse Description:
ectonucleoside triphosphate diphosphohydrolase 4 Gene [Source:MGI Symbol;Acc:MGI:1914714]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34503 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6105 Nonsense Mutation detected in F1 DNA During 2016
sa31685 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34502 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Essential Splice Site None 611 1 13
Genomic Location:
Chromosome 8 (position 52644181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGGATGGGTCTTAAATGAGGGCATCCGTCCCAGATGTAGCCGAACGG[T/C]GAGAGCATATGCCTGCGTTCACACACATATTCTAAATACTCAACCGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Nonsense 281 611 8 13
Genomic Location:
Chromosome 8 (position 52631767)
KASP Assay ID:
554-3817.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACRGCTGGTGTTTTGGACATGGGTGGCGTYTCCACTCAGATCGCATA[T/A]GAAGTGCCCAAAACTGTAAGCTTTGCTTCTCCACAACAGGTTATTATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Essential Splice Site 286 611 8 13
Genomic Location:
Chromosome 8 (position 52631750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATGGGTGGCGTTTCCACTCAGATCGCATATGAAGTGCCCAAAACTG[T/C]AAGCTTTGCTTCTCCACAACAGGTTATTATCTATGACAATTTCCCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056074 Nonsense 350 611 10 13
Genomic Location:
Chromosome 8 (position 52624560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTATGTGCTCCTGTTGTGTCCGTAGGCTGTTGAATCAGCATCAGGGA[G/T]AGAGCGCAGACTCGCCCATCCTGGACCCGTGTTTGCCTGTGGATCTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link