b3galt6

Ensembl ID:
ENSDARG00000038414
ZFIN ID:
ZDB-GENE-101104-13
Description:
beta-1,3-galactosyltransferase 6 [Source:RefSeq peptide;Acc:NP_001038690]
Human Orthologue:
B3GALT6
Human Description:
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 [Source:HGNC Symbol;Acc:17978]
Mouse Orthologue:
B3galt6
Mouse Description:
UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:215281

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41758 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082510 Nonsense 306 335 1 1
Genomic Location (Zv9):
Chromosome 11 (position 2667229)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2618967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACATGCTGGAGAAACACCAGACACTGCAGAGAGACGGACGCTTGTG[C/A]AAAGAGGAGGTCAAATTGCGGTTGTCTTATATCTACGACTGGAGCGTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link