NP_001104722.1

Ensembl ID:
ENSDARG00000038405
Description:
hypothetical protein LOC100007703 [Source:RefSeq peptide;Acc:NP_001104722]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6874 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31308 Nonsense Available for shipment Available now
sa33069 Nonsense Available for shipment Available now
sa19921 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056044 Essential Splice Site 31 569 None 4
ENSDART00000143220 Essential Splice Site 31 569 None 5
Genomic Location (Zv9):
Chromosome 3 (position 1829302)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1287514
KASP Assay ID:
554-5236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGTGTTTATCTATGGCTGGCGGTGCTCGCTGTAGTMAACACMGAGG[T/C]AAGGGCACTTGATCACACATGATGGTAATYAGRTGTWTTGCAGGAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056044 Nonsense 227 569 4 4
ENSDART00000143220 Nonsense 227 569 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1833665)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1291877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGTGTTTGATCGCATGCTTTCAGAACAGGAGAACAGTGAACACATT[G/T]AGGCAGAAATGAACCTCATGGTACGGAAGATGTCTGCAATGAACGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056044 Nonsense 356 569 4 4
ENSDART00000143220 Nonsense 356 569 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1834052)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1292264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGGACTTTTAATGAACTGTCTGGAAATAGGCTGGCTAATAAATTC[A/T]GAGATATTCGAGAGCGGCTGACCTCGTTTTACCAATCGATGAGGGTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056044 Nonsense 489 569 4 4
ENSDART00000143220 Nonsense 489 569 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1834451)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1292663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTACAGGAGTTTGTGAAAATGAACAGGTTTGATGCTCCAGAAGAGGAA[C/T]AACACCTGGTATCTGCAGCATCTGTCGGAAAATGGTTTCATAACTCTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link