rpap2

Ensembl ID:
ENSDARG00000038397
ZFIN ID:
ZDB-GENE-050522-420
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYH6]
Human Orthologue:
RPAP2
Human Description:
RNA polymerase II associated protein 2 [Source:HGNC Symbol;Acc:25791]
Mouse Orthologue:
Rpap2
Mouse Description:
RNA polymerase II associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2141142]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38314 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32852 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056034 Essential Splice Site 169 601 7 12
Genomic Location (Zv9):
Chromosome 2 (position 10605273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11030369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCAAAAAGTCCACCTGAGATTAAGCTGATGAAACAAGGAGATGGG[T/G]AAGTACTTGCTGTTTCTCTTTAAAAAAAATTATTTAACTTAAGATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056034 Nonsense 312 601 8 12
Genomic Location (Zv9):
Chromosome 2 (position 10604717)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11029813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATAAATCAACCCAACAGGAAGGTGAAAACACAAGCTCTTCACAGCCT[G/T]AATCTGACATCTCTGTTCCTGTGGCTGGCGACCTGAACATTACTCAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link