rpap2

Ensembl ID:
ENSDARG00000038397
ZFIN ID:
ZDB-GENE-050522-420
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UYH6]
Human Orthologue:
RPAP2
Human Description:
RNA polymerase II associated protein 2 [Source:HGNC Symbol;Acc:25791]
Mouse Orthologue:
Rpap2
Mouse Description:
RNA polymerase II associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2141142]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38314 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32852 Nonsense Mutation detected in F1 DNA During 2018
sa45091 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056034 Essential Splice Site 169 601 7 12
Genomic Location (Zv9):
Chromosome 2 (position 10605273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11030369
GRCz11 2 10813968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCAAAAAGTCCACCTGAGATTAAGCTGATGAAACAAGGAGATGGG[T/G]AAGTACTTGCTGTTTCTCTTTAAAAAAAATTATTTAACTTAAGATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056034 Nonsense 312 601 8 12
Genomic Location (Zv9):
Chromosome 2 (position 10604717)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11029813
GRCz11 2 10813412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATAAATCAACCCAACAGGAAGGTGAAAACACAAGCTCTTCACAGCCT[G/T]AATCTGACATCTCTGTTCCTGTGGCTGGCGACCTGAACATTACTCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056034 Essential Splice Site 551 601 12 12
Genomic Location (Zv9):
Chromosome 2 (position 10583043)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11008139
GRCz11 2 10791738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTTATTTACATGCTCATAGTTTAAAAATAATTTTGTTTGTTTGTTC[A/G]GGTTAACAGAAGTGTCACCATTGTTGCGAGAGTCGTTGGCGAGCGTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link