th2

Ensembl ID:
ENSDARG00000038384
ZFIN ID:
ZDB-GENE-050201-1
Description:
tyrosine hydroxylase 2 [Source:RefSeq peptide;Acc:NP_001001829]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2173 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056002 Essential Splice Site 299 471 8 12
ENSDART00000109299 Essential Splice Site 299 471 8 13
Genomic Location:
Chromosome 4 (position 16452652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGTTATTAAATCTATATTCTCTGGCTGACTCTTGTTTTATTTAATA[G/T]AGATTGCTGCCATGAACTACTTGGACATATTCCTATGCTTGCAGACCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j3m39742