sag

Ensembl ID:
ENSDARG00000038378
ZFIN ID:
ZDB-GENE-050913-98
Description:
S-antigen; retina and pineal gland (arrestin) [Source:RefSeq peptide;Acc:NP_001028921]
Human Orthologue:
SAG
Human Description:
S-antigen; retina and pineal gland (arrestin) [Source:HGNC Symbol;Acc:10521]
Mouse Orthologue:
Sag
Mouse Description:
retinal S-antigen Gene [Source:MGI Symbol;Acc:MGI:98227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36002 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22731 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055995 Essential Splice Site None 176 1 8
Genomic Location (Zv9):
Chromosome 15 (position 44848113)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45625581
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACACACAGGATCATCTGCGTCTCAACACACAAGCACACACAGACAGG[T/C]GAGTGATACTGCACGACTACGGCTGATCTCAGCACATTTACAGTAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055995 Essential Splice Site 154 176 7 8
Genomic Location (Zv9):
Chromosome 15 (position 44856112)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45633580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAATGTGCTGTGGAGTTTGAAGTGAAGGCCTTCTGTGCAGAAAATCAG[G/A]ATGAAAAAGCCCAAAAGAGGTAAGAAAAATCACAATCGCACAATTTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link