si:ch211-8c17.5

Ensembl ID:
ENSDARG00000038373
ZFIN ID:
ZDB-GENE-091204-290
Human Orthologue:
KCNJ2
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 2 [Source:HGNC Symbol;Acc:6263]
Mouse Orthologue:
Kcnj2
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 2 Gene [Source:MGI Symbol;Acc:MGI:104744]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055981 Nonsense 8 440 1 1
Genomic Location (Zv9):
Chromosome 3 (position 12405919)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12709730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGGCTCAGCCCCCTCATACGGAAGCGATGGGAAGCGTGAGAGCCCAY[C/T]GATACAGCATAGTTTCCTCAGAAGAAGGTGGGATGAAGTTGTCCCCCATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link