cldn15lb

Ensembl ID:
ENSDARG00000038372
ZFIN ID:
ZDB-GENE-040718-145
Description:
claudin 15-like b [Source:RefSeq peptide;Acc:NP_001002446]
Human Orthologues:
CLDN10, CLDN15
Human Descriptions:
claudin 10 [Source:HGNC Symbol;Acc:2033]
claudin 15 [Source:HGNC Symbol;Acc:2036]
Mouse Orthologues:
Cldn10, Cldn15
Mouse Descriptions:
claudin 10 Gene [Source:MGI Symbol;Acc:MGI:1913101]
claudin 15 Gene [Source:MGI Symbol;Acc:MGI:1913103]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2813 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2813
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098987 Nonsense 135 219 4 6
Genomic Location:
Chromosome 15 (position 44788085)
KASP Assay ID:
554-3134.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGCTTGCTCTCNNTCTCTGCAGGTTTGTGTGTTATCGTGGCCGTGTCGTG[G/A]TACGCTGCTCGAGTCGTCCAGGAATTTAATGACCCGTTTTATGGAGGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n38nxz18