cyp2k6

Ensembl ID:
ENSDARG00000038371
ZFIN ID:
ZDB-GENE-040426-1571
Description:
cytochrome P450, family 2, subfamily K, polypeptide 6 [Source:RefSeq peptide;Acc:NP_956803]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2134 Nonsense Mutation detected in F1 DNA During 2014
sa19953 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055979 Nonsense 65 505 1 10
ENSDART00000101326 Nonsense 65 505 1 9
Genomic Location:
Chromosome 3 (position 12450481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCCTCTGCTTGGGAATCTGCACATTCTCGACCTCAAGAAAACCTACT[T/A]GAGCCTTTTGGAGGTGAGCAAAAATATCAGTGTGTTTTTATTTTGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055979 Essential Splice Site 174 505 3 10
ENSDART00000101326 Essential Splice Site 174 505 3 9
Genomic Location:
Chromosome 3 (position 12445644)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTGAAGAGATTAAATATGTAAAGGAGGAATTTGAGAAGTTTGGAGG[T/C]AAGACTGTCAACCTTGAGGACAAGATGATGACGTGACTTTAAATGATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bn96ccjk