dnajc15

Ensembl ID:
ENSDARG00000038309
ZFIN ID:
ZDB-GENE-040801-216
Description:
dnaJ homolog subfamily C member 15 [Source:RefSeq peptide;Acc:NP_001003476]
Human Orthologue:
DNAJC15
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 15 [Source:HGNC Symbol;Acc:20325]
Mouse Orthologue:
Dnajc15
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 15 Gene [Source:MGI Symbol;Acc:MGI:1913398]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055872 Nonsense 132 149 6 6

The following transcripts of ENSDARG00000038309 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 18895470)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 18270139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATGCTGAAATATAACTGCTGCTTCTCCTGCAGGTGGATCCCCATATT[T/A]GGCAGCAAAGATCAATGAAGCAAAAGATCTGCTTGACTCTGGCCCTCGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link