tsc22d1

Ensembl ID:
ENSDARG00000038306
ZFIN ID:
ZDB-GENE-030131-7785
Description:
TSC22 domain family protein 1 [Source:RefSeq peptide;Acc:NP_997910]
Human Orthologue:
TSC22D1
Human Description:
TSC22 domain family, member 1 [Source:HGNC Symbol;Acc:16826]
Mouse Orthologue:
Tsc22d1
Mouse Description:
TSC22 domain family, member 1 Gene [Source:MGI Symbol;Acc:MGI:109127]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7626 Missense Mutation detected in F1 DNA During 2014
sa2483 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa7626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055868 None None 145 None 3
ENSDART00000131267 Missense 65 838 1 3
ENSDART00000131626 None None 118 None 3
ENSDART00000143165 None None 145 None 3
ENSDART00000145401 None None 133 None 3
Genomic Location:
Chromosome 9 (position 19432591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGATGTGTCTCTTCCACGGGCCAACAATTCAGGAGGWCCTGAAAGAA[G/T]CTCCTCTGAGGAGACGCTGAATAATTTTCATGAGGCGGAGACCCCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2483
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055868 None None 145 None 3
ENSDART00000131267 Nonsense 599 838 1 3
ENSDART00000131626 None None 118 None 3
ENSDART00000143165 None None 145 None 3
ENSDART00000145401 None None 133 None 3
Genomic Location:
Chromosome 9 (position 19430990)
KASP Assay ID:
554-2479.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCCAGGTTGTGCCGCAGCTGGTGCAGTCCACYGGCACCACTCTTATA[C/T]AGCAGACACCAGGCCAGCAGCTCACCTCACAACCCTCCATGGAGCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d6flwo5o