tmem86b

Ensembl ID:
ENSDARG00000038296
ZFIN ID:
ZDB-GENE-060825-132
Description:
transmembrane protein 86B [Source:RefSeq peptide;Acc:NP_001038833]
Human Orthologue:
TMEM86B
Human Description:
transmembrane protein 86B [Source:HGNC Symbol;Acc:28448]
Mouse Orthologue:
Tmem86b
Mouse Description:
transmembrane protein 86B Gene [Source:MGI Symbol;Acc:MGI:1915505]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15384 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055854 Nonsense 12 249 1 4
ENSDART00000132732 Nonsense 12 249 1 4
Genomic Location:
Chromosome 3 (position 16382594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACAGGCAAGAGAGATGGACATCCTGGAAACAAGTGCCTACGACCGC[A/T]GACAACGCAGAAACACGGTAATCACAGCRAACATACATCTGAGYSCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fhsof2gt