cd151

Ensembl ID:
ENSDARG00000038288
ZFIN ID:
ZDB-GENE-041010-137
Description:
CD151 molecule [Source:RefSeq peptide;Acc:NP_001006041]
Human Orthologues:
CD151, TSPAN11
Human Descriptions:
CD151 molecule (Raph blood group) [Source:HGNC Symbol;Acc:1630]
tetraspanin 11 [Source:HGNC Symbol;Acc:30795]
Mouse Orthologues:
Cd151, Tspan11
Mouse Descriptions:
CD151 antigen Gene [Source:MGI Symbol;Acc:MGI:1096360]
tetraspanin 11 Gene [Source:MGI Symbol;Acc:MGI:1915748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4305 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055843 Nonsense 201 252 6 8
Genomic Location:
Chromosome 25 (position 3867087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCCCCTCGGTGGGCTGTGGAGTCAGAGACCACCCATCCAACATCTA[T/A]AAAGTGGAGGTACTTTCAGATGASCTCAGTTATTTTTACATTTAAGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yciy5oi4