LOC561406

Ensembl ID:
ENSDARG00000038278
Human Orthologue:
PTGIR
Human Description:
prostaglandin I2 (prostacyclin) receptor (IP) [Source:HGNC Symbol;Acc:9602]
Mouse Orthologue:
Ptgir
Mouse Description:
prostaglandin I receptor (IP) Gene [Source:MGI Symbol;Acc:MGI:99535]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35812 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055829 Nonsense 91 364 1 2
Genomic Location (Zv9):
Chromosome 15 (position 9256817)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9145430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGTTTTCATCTGCTATGCCTACAGAACATCGCTGGTGGGACTGACT[G/T]GAGATCAGCGGCTCTGCGGACTCTTTGCCTTCGCCATGACCTTCTTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link