PIGG

Ensembl ID:
ENSDARG00000038270
Description:
phosphatidylinositol glycan anchor biosynthesis, class G [Source:HGNC Symbol;Acc:25985]
Human Orthologue:
PIGG
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class G [Source:HGNC Symbol;Acc:25985]
Mouse Orthologue:
Pigg
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class G Gene [Source:MGI Symbol;Acc:MGI:3576484]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28245 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055817 Nonsense 836 972 11 13
Genomic Location (Zv9):
Chromosome 14 (position 3917214)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3633905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAGAAGCTCCACTATGACGCCGCTCAGACCACCATCATGCACTACT[G/A]GTTCGGACAGGCATTCTTCTACTTCCAGGTAAGGAGGAGAGCGCACTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link