pdlim5

Ensembl ID:
ENSDARG00000038267
ZFIN ID:
ZDB-GENE-040718-401
Description:
PDZ and LIM domain 5 [Source:RefSeq peptide;Acc:NP_001002654]
Human Orthologue:
PDLIM5
Human Description:
PDZ and LIM domain 5 [Source:HGNC Symbol;Acc:17468]
Mouse Orthologue:
Pdlim5
Mouse Description:
PDZ and LIM domain 5 Gene [Source:MGI Symbol;Acc:MGI:1927489]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13197 Essential Splice Site Available for shipment Available now
sa26402 Nonsense Mutation detected in F1 DNA During 2017
sa18440 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099945 Essential Splice Site None 551 1 14
ENSDART00000145371 Essential Splice Site None 220 1 5
Genomic Location (Zv9):
Chromosome 5 (position 8559226)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7329878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCANNNCNNNGGAGTTTTGTTTTSCRTTTTGGGAAAAGTGMTGCTTTCTAAAGG[T/A]AAATCCATGATTGCATTGTTTATTGTRCTGTTGTTGTGGTTGCCAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099945 Nonsense 140 551 5 14
ENSDART00000145371 Nonsense 140 220 5 5
Genomic Location (Zv9):
Chromosome 5 (position 8622664)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7266477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACGTCATCCTCCAATAGGAGCGCTCGTCCATTTGGAGGGGCGGGGT[C/A]ACCACCCATAGCCTTCATTCCCTCCACTGCATCTGCTTTTGCACCCGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099945 Nonsense 212 551 5 14
ENSDART00000145371 Nonsense 212 220 5 5
Genomic Location (Zv9):
Chromosome 5 (position 8622879)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7266262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARAATGCCTGTGAGGTTGCCATGGGCCAGAGGCGGGGCCTGCTGGAAAGC[C/T]AGGGTGAGAGCTGTCAGCTRAATGGGTAAGAGTTTGATTGAYCCTTAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Identification of seven new prostate cancer susceptibility loci through a genome-wide association study. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link