e4f1

Ensembl ID:
ENSDARG00000038243
ZFIN ID:
ZDB-GENE-050913-103
Description:
Transcription factor E4F1 [Source:UniProtKB/Swiss-Prot;Acc:Q4V8R6]
Human Orthologue:
E4F1
Human Description:
E4F transcription factor 1 [Source:HGNC Symbol;Acc:3121]
Mouse Orthologue:
E4f1
Mouse Description:
E4F transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:109530]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40034 Nonsense Mutation detected in F1 DNA During 2017
sa40033 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44561 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33133 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055767 Nonsense 185 719 5 14
Genomic Location (Zv9):
Chromosome 3 (position 18550779)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18579141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCGAAACAGCGTTCAGGACCAAGGGCTCGTTAATCAGACACAAACGT[C/T]GACACACGGGTATGTCTAAGCTCTGTGAGACTGTGTCATTATACTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055767 Essential Splice Site 528 719 11 14
Genomic Location (Zv9):
Chromosome 3 (position 18542211)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18570573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGGCTTCGCTGAGCATGGAACTCTGAACCGCCATCTGCGAGCTAAAGG[T/C]CTGTCAGTGTGAATTAATCGAATTATACTCGCATTCATTAAAGCACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055767 Essential Splice Site 603 719 13 14
Genomic Location (Zv9):
Chromosome 3 (position 18536651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTCAAGGAGAAGAAGTGGCAATAATTCAAGACAATCAGCAGCAGG[T/C]GATTTCTCAAGTTTTCATTTTTATCATTGAAATTTCTATTGCACTTAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055767 Nonsense 656 719 14 14
Genomic Location (Zv9):
Chromosome 3 (position 18536387)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18564749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACTCTGGAGACACAATCACCATCGCCACACCAGAGAGCCTGACCGAA[C/T]AGGTAGCGATGACACTCGCAAACGCCATTAGCGATGGCACTATCCTTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link