tnpo2

Ensembl ID:
ENSDARG00000038239
ZFIN ID:
ZDB-GENE-040822-16
Description:
transportin-2 [Source:RefSeq peptide;Acc:NP_001004003]
Human Orthologue:
TNPO2
Human Description:
transportin 2 [Source:HGNC Symbol;Acc:19998]
Mouse Orthologue:
Tnpo2
Mouse Description:
transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6883 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33134 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055757 Essential Splice Site 216 889 7 25
Genomic Location:
Chromosome 3 (position 18639537)
KASP Assay ID:
554-5258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAGTAGAGCACAAGCCCTCATGGACAACATYGACACTTTTATTGAGG[T/C]ACTGATCCATGTGCAATGGATTTAATAATATCCATTCTTAAAGTTTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055757 Essential Splice Site 854 889 23 25
Genomic Location:
Chromosome 3 (position 18655466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTCCTGGGTTACTCCAAAAGACGATTTGAGGGACATGTTTTACAAGG[T/G]ACAAATATTTTTCTTCAGTAACTAAGCTTTTGATGAGTTTATAGTTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link