tnpo2

Ensembl ID:
ENSDARG00000038239
ZFIN ID:
ZDB-GENE-040822-16
Description:
transportin-2 [Source:RefSeq peptide;Acc:NP_001004003]
Human Orthologue:
TNPO2
Human Description:
transportin 2 [Source:HGNC Symbol;Acc:19998]
Mouse Orthologue:
Tnpo2
Mouse Description:
transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6883 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055757 Essential Splice Site 216 889 7 25
Genomic Location:
Chromosome 3 (position 18639537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTAGTAGAGCACAAGCCCTCATGGACAACATYGACACTTTTATTGAGG[T/C]ACTGATCCATGTGCAATGGATTTAATAATATCCATTCTTAAAGTTTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a9t737gv