LOC565254

Ensembl ID:
ENSDARG00000038235
Human Orthologue:
PKDCC
Human Description:
protein kinase domain containing, cytoplasmic homolog (mouse) [Source:HGNC Symbol;Acc:25123]
Mouse Orthologue:
Pkdcc
Mouse Description:
protein kinase domain containing, cytoplasmic Gene [Source:MGI Symbol;Acc:MGI:2147077]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14501 Nonsense Available for shipment Available now
sa15337 Nonsense Available for shipment Available now
sa18146 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055754 Nonsense 21 463 1 7
Genomic Location:
Chromosome 17 (position 31223214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGTCCGTTTTGCGYTTTYGTCCTCYTTGCTTTGTTGTTTTTGTCTT[T/A]AACGCTTAWTGTGAAAAAGTGGCACTTYGGTCTCCARGAGAACGAGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055754 Nonsense 63 463 1 7
Genomic Location:
Chromosome 17 (position 31223089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTGCTCCACAGCGCGAYACATTGCGCCAACAACTTCWGGAAAGACAA[C/T]AAGAACTTGTGCTYCTGGACATCACTTTTGAAGACATACAACAACAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055754 Essential Splice Site 217 463 2 7
Genomic Location:
Chromosome 17 (position 31222516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCAGATGATCCAGCTCCTGCAGAGCCCCTGGGAAGAGCGCTTTCGGG[T/C]AAGARCACCACCCCCAGGCCTCCTATGGAGTGTTAATCAGAGATTCYCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y8wayp3w