her2

Ensembl ID:
ENSDARG00000038205
ZFIN ID:
ZDB-GENE-980526-274
Description:
hairy-related 2 [Source:RefSeq peptide;Acc:NP_571164]
Human Orthologue:
HES5
Human Description:
hairy and enhancer of split 5 (Drosophila) [Source:HGNC Symbol;Acc:19764]
Mouse Orthologue:
Hes5
Mouse Description:
hairy and enhancer of split 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa49 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa49
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055709 Nonsense 66 108 2 2
Genomic Location:
Chromosome 11 (position 43073995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCGCGGAGCTACTCGGAAGCGCATGCGCAGAGCTATGCTGACGGATA[T/G]TCAAGATGCATTGAGGAAACGGCGCGATTTCTGTCAGCTCACAAACAAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/35sjy2gi