ndel1b

Ensembl ID:
ENSDARG00000038190
ZFIN ID:
ZDB-GENE-030131-5889
Description:
Nuclear distribution protein nudE-like 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q803Q2]
Human Orthologue:
NDEL1
Human Description:
nudE nuclear distribution gene E homolog (A. nidulans)-like 1 [Source:HGNC Symbol;Acc:17620]
Mouse Orthologue:
Ndel1
Mouse Description:
nuclear distribution gene E-like homolog 1 (A. nidulans) Gene [Source:MGI Symbol;Acc:MGI:1932915]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055682 Nonsense 310 344 8 9
Genomic Location (Zv9):
Chromosome 3 (position 49748963)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44443383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCAACAGCAATGCAACAAAGTTCTCTCATTCGCTTCACACAACATA[T/A]TTTGATAAGACGTAAGTACGTTGGTTTCTGCCCTCTTAACTGCACAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link