tcf7l1a

Ensembl ID:
ENSDARG00000038159
ZFIN ID:
ZDB-GENE-980605-30
Description:
Transcription factor 7-like 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q9YHE8]
Human Orthologue:
TCF7L1
Human Description:
transcription factor 7-like 1 (T-cell specific, HMG-box) [Source:HGNC Symbol;Acc:11640]
Mouse Orthologue:
Tcf7l1
Mouse Description:
transcription factor 7-like 1 (T-cell specific, HMG box) Gene [Source:MGI Symbol;Acc:MGI:1202876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa384 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099262 Nonsense 321 560 9 12
ENSDART00000140341 Nonsense 192 431 6 9

The following transcripts of ENSDARG00000038159 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 43567542)
KASP Assay ID:
554-0186.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCCCTCTTTCTCTCTCTCCATGCAGAAAGCCCTCGGTGCCCGTGAAG[A/T]AAGAGGAAGAGAAAAAGCCTCACATCAAGAAGCCTCTTAATGCCTTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wog333f9